Readme First 


TAREF: A tool to Refine microRNAs Target Prediction

please visit us at http://scbb.ihbt.res.in/  

1.System Requirement
2.Installation
3.Taref description
4.File formats
5.Running Taref


1.System requirement:

Linux 64 bit O.S. with Qt 

Major Linux distribution comes with Qt as an installed package if Qt is not installed then follow this simple procedure

Installing Qt:

For Ubuntu "sudo apt-get install libxtst-dev build-essential libqt4-dev qt4-qmake"   without quotes

For other Linux distribution  "yum install qt4 libqt4-*" as root

Or download Qt framework from http://qt.nokia.com/downloads 

2.Installing:

Extract TAREF_v_2.0.tar.gz migrate to folder TAREF_v_2.0 and run ./install as root for ubuntu sudo ./install it will check all the dependencies needed by Taref, install script will create Taref installer 
click on checkbox and then install button  (Remember Taref and Taref installer is made on Qt4.4 so you will need Qt4 installed on your system if Qt was not installed on your system ./install will not create any installer),

After installing all the dependencies installer will ask you in which folder you want to install Taref,
Default installation is on /home/(username)/TR but you can change it to some other folder. To configure Taref migrate to installation folder and run ./install (you need not to be log in as root for this command)
this will create a binary "All" .To launch Taref just double click on the binary "ALL".


3.Taref description:

Type1 
Type 1 takes the sequences in fasta format you can submit multiple sequences. Type 1 may take some time depending on your sequence file size. Type1 first generate RNAhybrid 
output then align the sequence and output from RNAhybrid using stretcher algorithm.

Type2
If you already have RNAhybrid output with you for same sequences then you can use Type2 instead of Type1.


4.File formats:

# For TYPE-1 :
Sequence should be in fasta format followed by Ensembl ID.
Sequences can be in multiple line or single line.
>ENSG00000102882
CCCAGACAGACATCACAGACATCTCTG
>ENSG00000184500
GGCATCTTTTCTCTGCTTATA

#For Type2:
sequences in fasta format like for Type1
and RNAhybrid output as

target: ENSG00000146232
length: 1051
miRNA : hsa-let-7a
length: 22

mfe: -21.8 kcal/mol
p-value: 0.958361

position  307
target 5'  G   GGU      GAA      A   3'
            UUG   CAGCCU   ACUGCC      
            GAU   GUUGGA   UGAUGG      
miRNA  3' UU   AU                AGU 5'


target: ENSG00000146232
length: 1051
miRNA : hsa-let-7a
length: 22

mfe: -20.6 kcal/mol
p-value: 0.996724

position  111
target 5' U      GC  GA     GG   A   3'
           GCUGUG  CA  GCCUG  GCC      
           UGAUAU  GU  UGGAU  UGG      
miRNA  3' U                 GA   AGU 5'


5.Running Taref:

Double click on the taref binary All select what type to launch Type1 or Type2 click on radio button to choose then click next

Type1:

Enter the sequence(s) file, choose the folder where you want to store the result file for type1 name of result file is "result_type1.-'time of your system'"  eg "result_type1.-16:41:17"
where time is 16hrs 41 min and 17 sec i.e 04:41:17 p.m

Type2:

Enter the sequence(s) file and RNAhybrid output, choose the folder where you want to store the result file for type2 name of result file is "result_type2.-'time of your system'" eg "result_type2.-16:41:17"


For any query comment please write to Dr. Ravi shankar ravish@ihbt.res.in and/or Ashwani jha ashwanijha.bioinfo@gmail.com